Skip to main content

How to Blast Protein Sequence in Linux?

Step 1: Create a BLAST Database from Your Protein File

If you haven't already created a BLAST database from the NbT2T.pep.fasta file, you need to do so using the makeblastdb command. This command generates the necessary index files for BLAST to search against.

Example Command to Create a Protein Database:

  1. Navigate to the directory where your NbT2T.pep.fasta file is located, or provide the full path to the file.
  2. Run the makeblastdb command to create a BLAST database.
makeblastdb -in NbT2T.pep.fasta -dbtype prot -out NbT2T_db

Explanation of parameters:

  • -in NbT2T.pep.fasta: This is your input protein sequence file in FASTA format.
  • -dbtype prot: Since you are working with a protein sequence database, specify prot.
  • -out NbT2T_db: This is the name of the output database, which will generate several files like NbT2T_db.nhr, NbT2T_db.nin, and NbT2T_db.nsq.

Step 2: Verify Database Files Exist

After running makeblastdb, you should see the following files in the directory:

  • NbT2T_db.nhr
  • NbT2T_db.nin
  • NbT2T_db.nsq

These files are the database indexes and are required by BLAST to perform the search. Ensure that they exist in the directory where you are running the BLAST search.

Step 3: Check the BLAST Search Path

If you're still encountering the error after creating the database, it's possible that BLAST cannot locate the database files. Make sure that the search path you're providing to the blastp or blastx command points to the correct location of the database files.

For example, if you created the database in the current directory, use the following command to run the BLAST search:

blastp -query protein.fasta -db NbT2T_db -out results.txt -outfmt 6

If your database is located in a different directory, provide the full or relative path to the database:

blastp -query protein.fasta -db /path/to/NbT2T_db -out results.txt -outfmt 6

Make sure you replace /path/to/NbT2T_db with the correct directory where your BLAST database files (NbT2T_db.nhr, NbT2T_db.nin, NbT2T_db.nsq) are located.

Step 4: Ensure Correct File Extensions

Sometimes, the error can occur if the file extensions do not match or if there is a typo in the file name. Verify that the database file (NbT2T.pep.fasta) is indeed in the right format and that the extension is .fasta or .fa. Also, ensure that the files created by makeblastdb are named consistently with the -out prefix you specified.

Step 5: Run BLAST Search Again

Once you've verified that the database is properly created and the search path is correct, run the BLAST search again:

blastp -query protein.fasta -db NbT2T_db -out results.txt -outfmt 6

Additional Troubleshooting Tips:

  1. Check for file permissions: Ensure that the database files (NbT2T_db.*) are readable and accessible by the user running the BLAST command.
  2. Ensure the database is created properly: If you suspect the database was not created correctly, delete the old database files and re-run makeblastdb.

Summary of Key Points:

  1. Create the BLAST database using makeblastdb:
    makeblastdb -in NbT2T.pep.fasta -dbtype prot -out NbT2T_db
    
  2. Verify the existence of the .nhr, .nin, and .nsq index files.
  3. Ensure you provide the correct path to the database when running the BLAST command.
  4. Run the BLAST search:
    blastp -query protein.fasta -db NbT2T_db -out results.txt -outfmt 6

Comments

Popular posts from this blog

Converting a Text File to a FASTA File: A Step-by-Step Guide

FASTA is one of the most commonly used formats in bioinformatics for representing nucleotide or protein sequences. Each sequence in a FASTA file is prefixed with a description line, starting with a > symbol, followed by the actual sequence data. In this post, we will guide you through converting a plain text file containing sequences into a properly formatted FASTA file. What is a FASTA File? A FASTA file consists of one or more sequences, where each sequence has: Header Line: Starts with > and includes a description or identifier for the sequence. Sequence Data: The actual nucleotide (e.g., A, T, G, C) or amino acid sequence, written in a single or multiple lines. Example of a FASTA file: >Sequence_1 ATCGTAGCTAGCTAGCTAGC >Sequence_2 GCTAGCTAGCATCGATCGAT Steps to Convert a Text File to FASTA Format 1. Prepare Your Text File Ensure that your text file contains sequences and, optionally, their corresponding identifiers. For example: Sequence_1 ATCGTAGCTAGCTA...

Understanding and Creating Area Charts with R and Python

Understanding and Creating Area Charts with R and Python What is an Area Chart? An Area Chart is a type of graph that displays quantitative data visually through the use of filled regions below a line or between multiple lines. It is particularly useful for showing changes in quantities over time or comparing multiple data series. The area is filled with color or shading to represent the magnitude of the values, and this makes area charts a great tool for visualizing the cumulative total or trends. Area charts are often used in: Time-series analysis to show trends over a period. Comparing multiple variables (stacked area charts can display multiple categories). Visualizing proportions , especially when showing a total over time and how it is divided among various components. Key Characteristics of an Area Chart X-axis typically represents time, categories, or any continuous variable. Y-axis represents the value of the variable being measured. Filled areas represent ...

Bubble Charts: A Detailed Guide with R and Python Code Examples

Bubble Charts: A Detailed Guide with R and Python Code Examples In data visualization, a Bubble Chart is a unique and effective way to display three dimensions of data. It is similar to a scatter plot, but with an additional dimension represented by the size of the bubbles. The position of each bubble corresponds to two variables (one on the x-axis and one on the y-axis), while the size of the bubble corresponds to the third variable. This makes bubble charts particularly useful when you want to visualize the relationship between three numeric variables in a two-dimensional space. In this blog post, we will explore the concept of bubble charts, their use cases, and how to create them using both R and Python . What is a Bubble Chart? A Bubble Chart is a variation of a scatter plot where each data point is represented by a circle (or bubble), and the size of the circle represents the value of a third variable. The x and y coordinates still represent two variables, but the third va...